View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15944_high_11 (Length: 222)
Name: NF15944_high_11
Description: NF15944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15944_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 44729731 - 44729542
Alignment:
| Q |
17 |
aatataatccaaattaatactagtgtcattgaaggaagtttagttgtgatattagaaggcatactgatgtgatggctattgttagaagcgctatgaa--- |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729731 |
aatataatccaaattaatactagtgtcattgaaggaagtttagttgtgatattagaaggcatactgatgtgatggctattgttagaagcgctatgaaggt |
44729632 |
T |
|
| Q |
114 |
ggttatgtggagggagaaaagctgtggggtccatatttaagagcagaattcaggggttgaaataaggacacaaatgttaacccttggcta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729631 |
ggttatgtggagggagaaaagctgtggggtccatatttaagagcagaattcaggggttgaaataaggacacaaatgttaacccttggcta |
44729542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University