View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15944_high_12 (Length: 217)
Name: NF15944_high_12
Description: NF15944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15944_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 3 - 215
Target Start/End: Original strand, 5451955 - 5452167
Alignment:
| Q |
3 |
tcttgttgattcaacaagaaaaatagactagctaatagtgacaatgacaaccaacaccaacaatggattcaaacaagaacaaatttagaaattatgtgta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5451955 |
tcttgttgattcaacaagaaaaatagactagctaatagtgacaatgacaaccaacaccaacaatggattcaaacaagaacaaatctagaaattatgtgta |
5452054 |
T |
 |
| Q |
103 |
aagcaaaaaagcaagctatccaatgagcaaagatagaggtcagaggaacagatacaaggagcaaagttatgttggggagtccaaggagcgccaaaggtaa |
202 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5452055 |
aagctaacaagcaagctatccaatgagcaaagatagaggtcagaggaacagatacaaggagcaaagttatgttggggagtccaaggagcgccaaaggtaa |
5452154 |
T |
 |
| Q |
203 |
aaacgagttaacg |
215 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5452155 |
aaacgagttaacg |
5452167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University