View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15944_high_5 (Length: 344)
Name: NF15944_high_5
Description: NF15944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15944_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 14 - 327
Target Start/End: Original strand, 48228986 - 48229299
Alignment:
| Q |
14 |
catagggggagcttaggttaccctagcatgaaagaaatcaaaatgacaaattcaaatcttgacctctgaactttaggctttttaatgttaccctcctttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48228986 |
catagggggagcttaggttaccctagcatgtaagaaatcaaaatgacaaattcaaatcttgacctctgaactttaggctttttaatgttaccctcctttt |
48229085 |
T |
 |
| Q |
114 |
ctattttttccaccagaaaaatagaattggttaatggccttttttgtttgcctttcaaagccaatatgatgaagctcaaacacttcatccaacggttgcg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48229086 |
ctattttttccaccagaaaaatagaattggttaatggccttttttgtttgcctttcaaagccaatatgatgaagctcaaacacttcatccaacggttgcg |
48229185 |
T |
 |
| Q |
214 |
ttctgttgttagatgtatatgttgaattttctttaagcagatatgacgcagcattatcaaagttatgtgattgttttatgaacactgatatgtgtctcga |
313 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48229186 |
ttctgttgttcgatgtatatgttgaattttctttaagcagatatgacgcagtattatcaaagttatgtgattgttttatgaacaccgatatgtgtctcga |
48229285 |
T |
 |
| Q |
314 |
agaaatgtgttaat |
327 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
48229286 |
agaaatgtgttaat |
48229299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University