View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15944_low_12 (Length: 296)
Name: NF15944_low_12
Description: NF15944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15944_low_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 14 - 296
Target Start/End: Complemental strand, 10125080 - 10124798
Alignment:
| Q |
14 |
ttttattttttggatatggtttagttatatggtagcctaaaaaatttgcaacaagttaggagtttttgttaccagtcttgctcatatctatccaatgtca |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10125080 |
ttttactttttggatatggtttagttatatggtagcctaaaaaatttgcaacaagttaggagtttttgttaccagtcttgctcatatctatccaatgtca |
10124981 |
T |
|
| Q |
114 |
taccctagtcttactcattcccttgaatttatgcattctttcacgtaacaaaccttttgattctacgttttctctctgatttctttcacaaatcacaacc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10124980 |
gaccctagtcttactcattcccttgaatttatgcattatttcacgtaacaaaccttttgattctacgttttctctctgatttctttcaaaaatcacaacc |
10124881 |
T |
|
| Q |
214 |
cattagagaacaatgaatgactctgaacaacccacacaaagtcttcctcttccgatgttaaccccgtttcaaagaatgtttgc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10124880 |
cattagagaacaatgaatgactctgaacaacccacacaaagtcttcctcttccgatgttaaccccgtttcaaagaatgtttgc |
10124798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 25043356 - 25043277
Alignment:
| Q |
206 |
tcacaacccattagagaacaatgaatgactctgaacaacccacacaaagtcttcctcttccgatgttaaccccgtttcaa |
285 |
Q |
| |
|
|||||| |||| |||||| |||||| |||||||||||||| | |||||||||||||||||||||| |||| | ||||||| |
|
|
| T |
25043356 |
tcacaatccataagagaaaaatgaacgactctgaacaaccgatacaaagtcttcctcttccgatgctaacgctgtttcaa |
25043277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 141
Target Start/End: Complemental strand, 25043466 - 25043422
Alignment:
| Q |
97 |
atatctatccaatgtcataccctagtcttactcattcccttgaat |
141 |
Q |
| |
|
||||||||||| ||| ||| || |||||||||||||||||||||| |
|
|
| T |
25043466 |
atatctatccattgttatatcccagtcttactcattcccttgaat |
25043422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University