View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15944_low_13 (Length: 287)
Name: NF15944_low_13
Description: NF15944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15944_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 16 - 205
Target Start/End: Original strand, 11333853 - 11334042
Alignment:
| Q |
16 |
ataaaacttaaagtacttcatgatactatggtgaagacaaattagtcactatgttactaagttagtgactaatttatattattgaagaaggctaatttag |
115 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11333853 |
ataaaacttaaagtacgtcatgatactatggtgaagacaaattagtcactatgttactaagttagtgactaatttatattattgaagaaggctaatttat |
11333952 |
T |
 |
| Q |
116 |
tttctnnnnnnnnttatccttgttataaattagcatacatgaatattgtgaaataaccaaaataaatcttcgttcgtaatgagtatccta |
205 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11333953 |
tttctaaaaaaaattatccttgttataaattagcatacatgaatattgtgaaataaccaaaataaatcttcgctcgtaatgagtatccta |
11334042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University