View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15944_low_14 (Length: 272)
Name: NF15944_low_14
Description: NF15944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15944_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 2 - 261
Target Start/End: Complemental strand, 5451860 - 5451594
Alignment:
| Q |
2 |
tcatcaaccaatcaagtaaaaagttttc-----ctttgagcatattgagagagttttctgaactgatttccaactcatatgtactcactctatggcaacc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5451860 |
tcatcaaccaatcaagtaaaaagttttcttttcctttgagcatattgagagagttttctgagctgatttccaactcatatgtactcactctatggcaacc |
5451761 |
T |
|
| Q |
97 |
aaaagtatagtactagtagtagcaattttgcatacgttattgagtgttagcaacactaactagatagtagctacatcaagag--ttcagtaaagcatagc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5451760 |
aaaagtatagtactagtagtagcaattttgcatacgttattgagtgttagcaacactaactagatagtagctacatcaagagaattcagtaaagcatagc |
5451661 |
T |
|
| Q |
195 |
actatttagttgtacttgaatttcttttactttcgttctctttttgtcactctatctattctttcat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5451660 |
actatttagttgtacttgaatttcttttactttcgttctctttttgtcactctatctattctttcat |
5451594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University