View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15944_low_17 (Length: 247)
Name: NF15944_low_17
Description: NF15944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15944_low_17 |
 |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0223 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 11 - 231
Target Start/End: Complemental strand, 21874 - 21656
Alignment:
| Q |
11 |
caaaggtcaaactttgacagtttgtataatggtaacaacgaaagacacttaaaagcacctatatattggtgcatagggcacaatcatatacaatatcaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21874 |
caaaggtcaaactttgacagtttgtataatggtaacaacgaaagacacttaaaagcacctatatattggtgcatagggcacaatcatatacaatatcaga |
21775 |
T |
 |
| Q |
111 |
aacctccccgtgattttcacctctgaaaaagttaaatgcttttttgagatttcatttctaaggttatagggaagggannnnnnnnnacacattgagggac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
21774 |
aacctccccgtgattttcacctctgaaaaagttaaatgcttttttgagatttcatttctaaggctatagggaaggga--gggggggacacattaagggac |
21677 |
T |
 |
| Q |
211 |
agcacctaccatagggcataa |
231 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21676 |
agcacctaccatagggcataa |
21656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University