View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15944_low_7 (Length: 352)
Name: NF15944_low_7
Description: NF15944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15944_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 12 - 337
Target Start/End: Complemental strand, 40651995 - 40651663
Alignment:
| Q |
12 |
atcatattcaagtattgaaattctactcttgaaatatgacctttacccactattagagaaatccaaccgaaacattttattcaaacaagatatctacaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40651995 |
atcatattcaagtattgaaattctactcttgagatatgacctttacccactattagagaaatccaaccgaaacattttattcaaacaggatatctacaat |
40651896 |
T |
|
| Q |
112 |
tgaatccccttccttttgaatacatcagttagaaacagttaca-------acactattaaaaataacatgctaactttgttctagaatacactttagttt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40651895 |
tgaatccccttccttttgaatacatcagttagaaacagttacagcaatttccactattaaaaataacatgctaactttgttctagaatacactttagttt |
40651796 |
T |
|
| Q |
205 |
tgggacttgtagctnnnnnnnncattgaaatcttacctgaaccatcttacgaaactcaattgtacggcttggaccatttgaacataaagaaaaggacacc |
304 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40651795 |
tgggacttgtagctaaaaaaaacattgaaatcttacctgaaccatcttacgaaactcaattgtacggcttggaccatttgaacataaagaaaaggacacc |
40651696 |
T |
|
| Q |
305 |
tacatgaatgtccgaattgttcgtcaatgtggt |
337 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |
|
|
| T |
40651695 |
tgcatgaatgtccgaattgttcgtcaatgtggt |
40651663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 238 - 284
Target Start/End: Complemental strand, 40666656 - 40666610
Alignment:
| Q |
238 |
tacctgaaccatcttacgaaactcaattgtacggcttggaccatttg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40666656 |
tacctgaaccatcttacgaaactcaattgtacggtttggaccatttg |
40666610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University