View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15945_high_27 (Length: 263)
Name: NF15945_high_27
Description: NF15945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15945_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 52566013 - 52566107
Alignment:
| Q |
19 |
ctcatggcgttatcttatggattagtccatggttgagcttaattagttcattggttcaatttaagaatattgttcactaggtttttgatactact |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52566013 |
ctcatggcgttatcttatggattagtccatggttgagcttaattagttcattggttcaatttaagaatattgttcactaggtttttgatactact |
52566107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 183 - 259
Target Start/End: Original strand, 33771420 - 33771496
Alignment:
| Q |
183 |
catttacccgaatgttatctactaccaatgcaatttccctcatcttccgctcccgtgcttctgccggagaccccacc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33771420 |
catttacccgaatgttatctactaccaatgcaatttccctcatcttccgctcccgtgcttctgccggagaccccacc |
33771496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University