View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15945_high_29 (Length: 247)
Name: NF15945_high_29
Description: NF15945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15945_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 37 - 178
Target Start/End: Complemental strand, 14335563 - 14335422
Alignment:
| Q |
37 |
aatattttaattgagatgaatttgactttgtttaataaggagaccaacttgacgtagaccaaatattgattttgaacattccataacgaggatgccctac |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14335563 |
aatattttaattgagatgaatttgactttgtttaataaggagaccaacttgacgtagaccaaatattgattttgaacattccataacgaggatgccctac |
14335464 |
T |
 |
| Q |
137 |
ttttgacgatatgtgcttcaccccaattatttagtactcttc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14335463 |
ttttgacgatatgtgcttcaccccaattatttagtactcttc |
14335422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 240
Target Start/End: Complemental strand, 44968760 - 44968695
Alignment:
| Q |
175 |
cttcataactcttgtcaatagcaagtacaacgcataaataaaatgtacaagtgttattctcatctc |
240 |
Q |
| |
|
||||||| ||||||| |||||||||| ||| |||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
44968760 |
cttcatagctcttgtaaatagcaagttcaattcataaataaaatttacaagttttattttcatctc |
44968695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University