View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15945_low_3 (Length: 486)
Name: NF15945_low_3
Description: NF15945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15945_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 6e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 17 - 120
Target Start/End: Original strand, 52034611 - 52034714
Alignment:
| Q |
17 |
tgaacacggagactccacttattcacttaagagacaannnnnnnagccgaaaagccagttgacaacaataaaaaatgtcactcttttataaaacaaatgt |
116 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52034611 |
tgaacacggaaactccacttattcacttaagagacgatttttttagccgaaaagccagttgacaacaataaaaaacgtcactcttttataaaacaaatgt |
52034710 |
T |
 |
| Q |
117 |
cact |
120 |
Q |
| |
|
|||| |
|
|
| T |
52034711 |
cact |
52034714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University