View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15945_low_35 (Length: 238)
Name: NF15945_low_35
Description: NF15945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15945_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 46212642 - 46212444
Alignment:
| Q |
1 |
ataggacatgataatgttaaaaagctaaaggtctattgattgaggactcaactcaatttacttttcttcactttgagatagattccnnnnnnn--aacta |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46212642 |
ataggacatgataatgttaaaaagctaaaggtctattgattgaggactcaactcaatttacttttcttcactttgagatagattcctttttttttaacta |
46212543 |
T |
 |
| Q |
99 |
atatgaaaatttaagggagctgggttgcaaaagtttactagggtgaggacaatttccaaggttaaaaaaccactttcaaagatgattaagacctaaggg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46212542 |
atatgaaaatttaagggagctgggttgcaaaagtttactagggtgaggacaatttccaaggttaaaaaaccactttcaaagatgattaagacctaaggg |
46212444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University