View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15946_high_9 (Length: 300)
Name: NF15946_high_9
Description: NF15946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15946_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 41 - 290
Target Start/End: Original strand, 49858265 - 49858512
Alignment:
| Q |
41 |
aaatttacgaaaactatgggnnnnnnncgtgacaatatacgaaaattctacaagagaaagagaatgttgaataccgttggaataggaggttgagaaaatt |
140 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49858265 |
aaatatacgaaaactatggggaaaaaacgtgacaatatacgaaaattctgcaagaga--gataatgttgaataccgttggaataggaggttgagaaaatt |
49858362 |
T |
|
| Q |
141 |
ggctgatcaaaagaacagaaaacgatcatccagtgtcgactcgctgggatgcgaaaacaattccatcctcacagaaaattcccgttccacttgacggaag |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49858363 |
ggctgatcaaaagaacagaaaacgatcatccagtgtcgactcgctgggatgcgaaaacaattccatcctcacagaaaattcccgttccacttgacggaag |
49858462 |
T |
|
| Q |
241 |
cagaaggatgtacttcatacacacgcacgctcaattttaattttcctatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49858463 |
cagaaggatgtacttcatacacacgcacgctcaattttaattttcctatg |
49858512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University