View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15947_low_4 (Length: 276)
Name: NF15947_low_4
Description: NF15947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15947_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 24 - 261
Target Start/End: Original strand, 55721726 - 55721963
Alignment:
| Q |
24 |
tgcaaacacttacctactctaaagcacctttaacccatgtagagggttgcatctatatttctttttggttcttcatttaggattttgtccactggtattg |
123 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55721726 |
tgcaaacacatacctactctaaagcacctttaacccatgtagagggttgcatctatatttctttttggttcttcatttaggattttgtccactggtattg |
55721825 |
T |
|
| Q |
124 |
tgcctgcatgtctcctttgatgagcttcggctcccatcccttgaatacaagaccaatcacgaagcatatcatgtgttcgtcgtataaaagtctttttctc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55721826 |
tgcctgcatgtctcctttgatgagcttcggctcccatcccttgaatacaagaccaatcacgaagcatatcatgtgttcgtcgtataaaagtctttttctc |
55721925 |
T |
|
| Q |
224 |
ttatttattactcattatgtcgcctctattgacactat |
261 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55721926 |
ttatttatgactcattatgtcgcctctattgacactat |
55721963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University