View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15948_high_3 (Length: 507)
Name: NF15948_high_3
Description: NF15948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15948_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-153; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 177 - 491
Target Start/End: Original strand, 21013421 - 21013735
Alignment:
| Q |
177 |
ttagatataaaaaagttttagaggtttattatatccatggaagaagtagaaaagaggtatatatccacagttgttggtgaaaccgtagacgagtctgtgg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21013421 |
ttagatataaaaaagttttagaggtttattatatccatggaagaagtagaaaagaggtatatatccacagttgttggcgaaaccgtagacgagtctgtgg |
21013520 |
T |
 |
| Q |
277 |
aatgtggtggtcagatagttgaggatttgagtggagaagctgggattgagaatgccgccgcagtgaagttggatagagtggtttcggaaagggaagtgag |
376 |
Q |
| |
|
||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21013521 |
aatatggtggtcagatagttgagcatttgagtggagaagctgagattgagaatgccgccgcagttaagttggatagagtggtttcggaaagggaagcgag |
21013620 |
T |
 |
| Q |
377 |
gtatcaatcaatagttggcactgactcttgcactatggaggatgctgctgaggccgcaggtcacccgtcgacatcactatttgctgacattttggaaaca |
476 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| | |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21013621 |
gtatcaatcaatagttggcactgactcttgcgctatggatgctgctgctgaggcagcaggtcacccgtcgacatcactatttgctgacattttggaaaca |
21013720 |
T |
 |
| Q |
477 |
attgattcaatattg |
491 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21013721 |
attgattcaatattg |
21013735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 8 - 113
Target Start/End: Original strand, 21013252 - 21013357
Alignment:
| Q |
8 |
attattctatttttcttcccttttgtttctttatcgtttctacttttgttgttatcaaactaggttgattttaggaaactattgcattagggtctctata |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21013252 |
attactctatttttcttcccttttgtttctttatcgtttctacttttgttgttatcaaactaggtttattttaggaaactattgcattagggtctctata |
21013351 |
T |
 |
| Q |
108 |
gatttc |
113 |
Q |
| |
|
|||||| |
|
|
| T |
21013352 |
gatttc |
21013357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 299 - 409
Target Start/End: Complemental strand, 3516860 - 3516753
Alignment:
| Q |
299 |
ggatttgagtggagaagctgggattgagaatgccgccgcagtgaagttggatagagtggtttcggaaagggaagtgaggtatcaatcaatagttggcact |
398 |
Q |
| |
|
||||||||||||||||||||||| ||||||| | ||||| ||||||||||| ||||||| || |||||||||||| | ||||||||| |||| ||| |
|
|
| T |
3516860 |
ggatttgagtggagaagctgggagtgagaat---gtggcagttaagttggatagcatggtttcagagagggaagtgagggaccaatcaataattggtact |
3516764 |
T |
 |
| Q |
399 |
gactcttgcac |
409 |
Q |
| |
|
||||||||| |
|
|
| T |
3516763 |
cgctcttgcac |
3516753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University