View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15948_high_9 (Length: 209)
Name: NF15948_high_9
Description: NF15948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15948_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 4 - 203
Target Start/End: Original strand, 38250168 - 38250367
Alignment:
| Q |
4 |
gcaccaagggaatcattacatatgagaatatctaacaaagatttctctattacagctaagtagaatgagctcgatatgcaagatggtttgcacatttatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38250168 |
gcaccaagggaatcattacatatgagaatatctaacaaagatttctctattacagctaagtagaatgagctcgatatgcaagatggtttgcacatttatt |
38250267 |
T |
 |
| Q |
104 |
tgcatcgcagttaatatgatataactcaagtgcatatttggagtatggtgcaactacatggcagataagaaatattggtataaccatgttgaatcgtatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38250268 |
tgcatcgcagttaatatgatataactcaagtgcatatttggagtatggtgcaagtacatggcagataagaaatattggtataaccatgttgaatcgtatt |
38250367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 103
Target Start/End: Original strand, 32738663 - 32738705
Alignment:
| Q |
61 |
aagtagaatgagctcgatatgcaagatggtttgcacatttatt |
103 |
Q |
| |
|
|||||||||||||||||| || |||| |||||||||||||||| |
|
|
| T |
32738663 |
aagtagaatgagctcgatgtgaaagaaggtttgcacatttatt |
32738705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University