View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1594R-Insertion-10 (Length: 273)
Name: NF1594R-Insertion-10
Description: NF1594R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1594R-Insertion-10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 8 - 163
Target Start/End: Complemental strand, 2017780 - 2017625
Alignment:
| Q |
8 |
aacattttgtatctcaaaatataacaaaaacattctcagttccaacacannnnnnnnnccattcacattccgcgaaatcaatggttgatgatgatgatct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2017780 |
aacattttgtatctcaaaatataacaaaaacattctcagttccaacactttttttttttcattcacattccgcgaaatcaatggttgatgatgatgatct |
2017681 |
T |
 |
| Q |
108 |
gcctcgacgagattaatatggtgcatgcatgcattttgttaagaacgcttattgtg |
163 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2017680 |
gccgcgacgcgattaatatggtgcatgcatgcattttgttaagaacgcttattgtg |
2017625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 158 - 246
Target Start/End: Complemental strand, 2017324 - 2017236
Alignment:
| Q |
158 |
attgtggccgcaatttgcggtggaattgaatccgaaaaaatgatagagaataacctggatggagagttcttggcggccgatgatcaact |
246 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2017324 |
attgtgcccgcaatttgcggtggaattgaatccgaaaaaatgatagacaataacctggatggagagttcttggcgtccgatgatcaact |
2017236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University