View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1594R-Insertion-12 (Length: 161)
Name: NF1594R-Insertion-12
Description: NF1594R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1594R-Insertion-12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 12 - 161
Target Start/End: Complemental strand, 56069465 - 56069303
Alignment:
| Q |
12 |
tcgagataagtattcaaaagtttcaaggttattggacgaagtacgttcattatgattctgtgtatttgcgagaatgcaacatccatccataataaaggtc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56069465 |
tcgagataagtattcaaaagtttcaaggttattggacgaagtacattcattatgattctgtgtatttgcgagaatgcaacatccatccataataaaggtc |
56069366 |
T |
|
| Q |
112 |
aa-------------ttgcaatccattatataatttattattctttttgtatacatggcttgc |
161 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56069365 |
aatgcaccttataggttgcaatccattatataatttattattctttttgtatacatggcttgc |
56069303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000006
Query Start/End: Original strand, 14 - 105
Target Start/End: Original strand, 38398870 - 38398961
Alignment:
| Q |
14 |
gagataagtattcaaaagtttcaaggttattggacgaagtacgttcattatgattctgtgtatttgcgagaatgcaacatccatccataata |
105 |
Q |
| |
|
||||||||||| | |||||| ||||||||||||||||||| ||| ||||||| || |||||||||||||||||| ||| ||| |||||| |
|
|
| T |
38398870 |
gagataagtataccgaagtttaaaggttattggacgaagtatgttgattatgagagtgagtatttgcgagaatgcaatatcaatcaataata |
38398961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University