View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1594_high_2 (Length: 457)
Name: NF1594_high_2
Description: NF1594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1594_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 331; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 347
Target Start/End: Complemental strand, 47509752 - 47509406
Alignment:
| Q |
1 |
atagataagaaacctttgagttcatcggcgatggcggcgatgtagagtttaaggatttcagaggctttagcaggttggtactcggtctcaagggataaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47509752 |
atagataagaaacctttgagttcatcggcgatggcggcgatgtagagtttaaggatttcagaggctttagcaggttggtactcggtctcaagggaaaaga |
47509653 |
T |
 |
| Q |
101 |
aaacataggcatcggagttactgctacggaggcggttgagagcagaggttttgagaggatcaggtaaaggaagatcgaagagagaaagagaagcacgtga |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47509652 |
caacatcggcatcggagttactgctacggaggcggttgagagcagaggttttgagaggatcaggtaaaggaagatcgaagagagaaagagaagcacgtga |
47509553 |
T |
 |
| Q |
201 |
atgagcaatgtcgagtaattgagctccggtgaacgcacgatcaaagacggtggaagatagatcgaggtctctgaggttagttccgtcaagtatctgcaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47509552 |
atgagcaatgtcgagtaattgagctccggtgaacgcacgatcaaagacggtggaagatagatcgaggtctctgaggttagttccgtcaagtatctgcaat |
47509453 |
T |
 |
| Q |
301 |
tgaaaagctcctccgtctgacattttggtttacggttacgactttgc |
347 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47509452 |
tgaaacgctcctccgtctgacattttggtttacggttacgactttgc |
47509406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 392 - 441
Target Start/End: Complemental strand, 47509368 - 47509319
Alignment:
| Q |
392 |
aggaacaaagacttgaaagttaggaatagtattaatcaattcaattcaat |
441 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47509368 |
aggaacaaagacttgaaagttaggagtagtattaatcaattcaattcaat |
47509319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University