View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1594_high_5 (Length: 265)

Name: NF1594_high_5
Description: NF1594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1594_high_5
NF1594_high_5
[»] chr6 (1 HSPs)
chr6 (69-245)||(22579732-22579908)


Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 69 - 245
Target Start/End: Complemental strand, 22579908 - 22579732
Alignment:
69 caatacttcacttttaaatgaggggagtcaactagaagaataagaaagattatttggaaatttatccacaagtccaagatcaaaaaccgaagaaataaat 168  Q
    |||||||||||||| ||||||| ||||||||||||||||||| ||| || ||||||||||||||||||||| ||| ||||||||||| ||||||||||||    
22579908 caatacttcactttgaaatgagaggagtcaactagaagaataggaaggagtatttggaaatttatccacaattcccagatcaaaaacagaagaaataaat 22579809  T
169 ggaatatgtcaagtcttatatatcttcgtgaatgacgagatcagaaactagtcaattagcatgttgtatatcccaaa 245  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
22579808 ggaatatgtcaactcttatatatcttcgtgaatgacgagatcagaaactcgtcaattagcatgttgtatatcccaaa 22579732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University