View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1594_high_5 (Length: 265)
Name: NF1594_high_5
Description: NF1594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1594_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 69 - 245
Target Start/End: Complemental strand, 22579908 - 22579732
Alignment:
| Q |
69 |
caatacttcacttttaaatgaggggagtcaactagaagaataagaaagattatttggaaatttatccacaagtccaagatcaaaaaccgaagaaataaat |
168 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||| ||| || ||||||||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
22579908 |
caatacttcactttgaaatgagaggagtcaactagaagaataggaaggagtatttggaaatttatccacaattcccagatcaaaaacagaagaaataaat |
22579809 |
T |
 |
| Q |
169 |
ggaatatgtcaagtcttatatatcttcgtgaatgacgagatcagaaactagtcaattagcatgttgtatatcccaaa |
245 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22579808 |
ggaatatgtcaactcttatatatcttcgtgaatgacgagatcagaaactcgtcaattagcatgttgtatatcccaaa |
22579732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University