View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1594_high_6 (Length: 254)
Name: NF1594_high_6
Description: NF1594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1594_high_6 |
 |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 21916164 - 21915924
Alignment:
| Q |
1 |
agaacaattctctttgtgctgcatcaaatacactgcacttgtttaannnnnnn--agctatgcatgtgttttggaccaaacnnnnnnnntt-ggatatgt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||| | |
|
|
| T |
21916164 |
agaacaattctctttgtgctgcatcaaatacactgcacttgtttaatttttttttagctatgcatgtgttttggaccaaacaatttttttttggatat-t |
21916066 |
T |
 |
| Q |
98 |
ttggtgtggcacttgccacaccaggacctt-aacaggtccgtccctgaatggagccaaagnnnnnnnnttctttcttccgatgctttgtcaagtaattta |
196 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21916065 |
ttggtgtgagacttgccacaccaggacctttaacaggtccgtccctgcatggagccaaagaaaaaaa-ttctttcttccgatgctttgtcaagtaattta |
21915967 |
T |
 |
| Q |
197 |
tcttctgggaagtgcttacctatagcttttgattctcatatgc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21915966 |
tcttctgggaagtgcttacctatagcttttgattctcatatgc |
21915924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 88 - 143
Target Start/End: Complemental strand, 4136977 - 4136922
Alignment:
| Q |
88 |
ttggatatgtttggtgtggcacttgccacaccaggaccttaacaggtccgtccctg |
143 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4136977 |
ttggacatgtttggtgtgacacttgccacaccaggaccttaacaggtccgcccctg |
4136922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 90 - 135
Target Start/End: Original strand, 17109403 - 17109448
Alignment:
| Q |
90 |
ggatatgtttggtgtggcacttgccacaccaggaccttaacaggtc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17109403 |
ggatatgtttggtgtggcacttgccacaccaggaccttaataggtc |
17109448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 56 - 137
Target Start/End: Original strand, 45867968 - 45868049
Alignment:
| Q |
56 |
ctatgcatgtgttttggaccaaacnnnnnnnnttggatatgtttggtgtggcacttgccacaccaggaccttaacaggtccg |
137 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
45867968 |
ctatgcttgtgttttggaccaaacaaaaaaaattggatatgattggtgtggcacttaccacatcaggaccttaacaggtccg |
45868049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 88 - 143
Target Start/End: Original strand, 17151 - 17206
Alignment:
| Q |
88 |
ttggatatgtttggtgtggcacttgccacaccaggaccttaacaggtccgtccctg |
143 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| || |||||||||||| ||||| |
|
|
| T |
17151 |
ttggatatgtttggtgtggcactttctacaccagaactttaacaggtccgcccctg |
17206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University