View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1594_high_7 (Length: 251)
Name: NF1594_high_7
Description: NF1594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1594_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 51899127 - 51899366
Alignment:
| Q |
1 |
tagtttagactctttttgcagttggaggtaatgctaagcatgaaatgaaaactgaaacatagaaatgttannnnnnn--ctctgactgtgactaatgttg |
98 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51899127 |
tagtttagactctttttgtagttggaggtaaagctaagcatgaaatgaaaactgaaacatagaaatgttatttttttttctctgactgtgactaatgttg |
51899226 |
T |
 |
| Q |
99 |
aaattgaaaaaggtctctttctctttatgttttgattgattcatgatggatctgtaatcagtttccatgtgtttcactgttttagaattttaatgaggcc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
51899227 |
aaattgaaaaaggtctctttctctttatgttttgattgattcatgatggatctgtaatcagtttccatgtttttcactgttttagaattttcatgaggcc |
51899326 |
T |
 |
| Q |
199 |
agtctgatattaataactttagtgttagactttttcccct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51899327 |
agtctgatattaataactttagtgttagactttttcccct |
51899366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University