View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15950_high_6 (Length: 271)
Name: NF15950_high_6
Description: NF15950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15950_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 258
Target Start/End: Original strand, 3256682 - 3256919
Alignment:
| Q |
19 |
ggtaacgcattttgtgtttttgtcttgttgcgccgggacctgtgagaaatgagaaattgtgtaacgactactaataacgatacaaaatttgaattttatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3256682 |
ggtaacgcattttgtgtttttgtcttgttgcgccgggacctgtgag-------aaattgtgtaacgactactaataacgatacaaaatttgaattttatg |
3256774 |
T |
|
| Q |
119 |
gacagatggacggatttacccttttgtttggatattgaatttctaatacc-----ttgggttttgttttggggtcactctctgatcacattctgtgtcca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3256775 |
gacagatggacggatttacccttttgtttggatattgaatttctaataccttggtttgggttttgttttgaggtcactctctgatcacattctgtgtcca |
3256874 |
T |
|
| Q |
214 |
ctgtccagtgtgcatcgctctgcaatttcggcgcttctgctattc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3256875 |
ctgtccagtgtgcatcgctctgcaatttcggcgcttctgctattc |
3256919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University