View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15950_low_10 (Length: 295)
Name: NF15950_low_10
Description: NF15950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15950_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 14 - 247
Target Start/End: Complemental strand, 42214460 - 42214227
Alignment:
| Q |
14 |
gaacctttaaggacttgagaggttgaaaatttgaaggcaatgatgagccttgcaagttcaatgatttcaagtttatctcttctacctctccttgtaaatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42214460 |
gaacctttaaggacttgagaggttgaaaatttgaaggcaatgatgagccttgcaagttcaatgatttcaagtttatctcttctacctctccttgtaaatt |
42214361 |
T |
|
| Q |
114 |
gcacttcacaccaaaccaattacatggtgtttggtttgaaaggttccaagatgctaatacatctgaagtagtgtttaaactctccttccatgctataaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42214360 |
gcacttcacaccaaaccaattacatggtgtttggtttgaaaggttccaagatgctaatacatctgaagtagtgtttaaactctccttccatgctataaga |
42214261 |
T |
|
| Q |
214 |
gcttggccttgttcatcaagagagttacaacatg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42214260 |
gcttggccttgttcatcaagagagttacaacatg |
42214227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 24155877 - 24155754
Alignment:
| Q |
18 |
ctttaaggacttgagaggttgaaaatttgaaggcaatgatgagccttgcaagttcaatgatttcaagtttatctcttctacctctccttgtaaattgcac |
117 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | ||||||||| ||||||| ||| ||||||||||||||| || ||||| ||| ||||||| |
|
|
| T |
24155877 |
ctttaaggacttcagagattgaaaatttgaagg---taatgagccttctaagttcattgacttcaagtttatctctatcacatctccctgtgaattgcaa |
24155781 |
T |
|
| Q |
118 |
ttcacaccaaaccaattacatggtgtt |
144 |
Q |
| |
|
||| ||||||||||| || |||||| |
|
|
| T |
24155780 |
aacactccaaaccaattgcaaggtgtt |
24155754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University