View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15950_low_11 (Length: 286)
Name: NF15950_low_11
Description: NF15950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15950_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 209
Target Start/End: Original strand, 39366377 - 39366566
Alignment:
| Q |
20 |
tttggctcagccacagctcatgtttcagaaccctagactagatgggattattatcctaacatctctagcatgtg----attcatatcatgtgtcacgcaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
39366377 |
tttggctcagccacagctcatgtttcagaaccctagactagatgggattattatcctaacatctcaagcatatgtatgattcatatcatgtgtcacgcaa |
39366476 |
T |
|
| Q |
116 |
tataccaaataaatgcaactgtctttaggctaaaaatagcatactgaattactgattattaattaacccatagcctatgctattgttaactatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
39366477 |
tataccaaataaatgcaactgtctttaagctaaaaatagcatactgaattactgatt----attaacccatagccgatgctattgttaattatt |
39366566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 252
Target Start/End: Original strand, 39366594 - 39366638
Alignment:
| Q |
208 |
ttgtgatgtgatgcagcattgtgttttggtatccacataagcaca |
252 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
39366594 |
ttgtgatgtgatgctgcattgtgtttgggtgtccacataagcaca |
39366638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University