View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15950_low_9 (Length: 300)
Name: NF15950_low_9
Description: NF15950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15950_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 17 - 285
Target Start/End: Original strand, 38362857 - 38363125
Alignment:
| Q |
17 |
aattttgtcaacggctcaattatatggttccttaattaaactttgcaggcaatagtactgtagctaagctagggaatcacatgatattatccccttttct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38362857 |
aattttgtcaacggctcaattatatggttccttaattaaactttgcaggcaatagtactgtagctaagctaggtaatcacatgatattatccccttttct |
38362956 |
T |
|
| Q |
117 |
tcctcattgtcatatttattaggaaaacgtgaaatatgagaataataattgtaaaaattgcaggaaaatcattagaatgtgttatttaaatgcaaacatt |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38362957 |
tcctcattgtcatatttattaggaacacgtgaaatatgagaataataattgtaaaaattgcaagaaaatcattataatgtgttatttaaatgcaaacatt |
38363056 |
T |
|
| Q |
217 |
aactacattttaggctccataattaataatacagtctttcatttaagccaatggatccttactcctttg |
285 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
38363057 |
aactacattttaggctctataattaataattcagtctttcatttaaactaatggatccttactcctttg |
38363125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 101
Target Start/End: Original strand, 38369202 - 38369247
Alignment:
| Q |
57 |
ctttgcaggcaatagta-ctgtagctaagctagggaatcacatgat |
101 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
38369202 |
ctttgcagccaatactatctgtagctaagctagggaatcacatgat |
38369247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University