View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15951_low_7 (Length: 337)
Name: NF15951_low_7
Description: NF15951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15951_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 21 - 327
Target Start/End: Complemental strand, 21012807 - 21012501
Alignment:
| Q |
21 |
attagattattcctacgaatcagttttttattttgaagggaaatggtcaatagttagttagtgctcacttggaccatgatatatccattaattttacaaa |
120 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21012807 |
attagattattccatcgaatcagttttttattttgaagggaaatagtcaatagttagttagtgctcacttggaccatgatatatccattaattttacaaa |
21012708 |
T |
 |
| Q |
121 |
tcatcatacacctaatataaaaagttcataaatcgattgactttttgtaaatggatcatgaacggttgtcatgatcactcagttgttagggacatcatat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21012707 |
tcatcatacacctaatataaaaagttcataaatcgattgacgttttgtaaatggatcatgaacggttgtcatgatcactcggttgttagggacatcatat |
21012608 |
T |
 |
| Q |
221 |
tttatatgtagagacagaggcggggtggcgtgaggacataggatggtcatggtttatccattcatttgtggaaatgattttttctcctaaacgtgtcttc |
320 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21012607 |
tttatatgtagagatagaggcggggtcacgtgaggacatagaatggtcatagtttatccattaatttgtggaaatgattttttctcctaaacgtgtcttc |
21012508 |
T |
 |
| Q |
321 |
ttctctc |
327 |
Q |
| |
|
|| |||| |
|
|
| T |
21012507 |
ttttctc |
21012501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University