View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15952_high_15 (Length: 222)
Name: NF15952_high_15
Description: NF15952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15952_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 84 - 204
Target Start/End: Complemental strand, 6640531 - 6640411
Alignment:
| Q |
84 |
gaagaaacttggaaaactctagcattcataagccttgttgcatcgggtatgagctctttcaatgtacccatcttctcattctgcagagcgcagacatctg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6640531 |
gaagaaacttggaaaactctagcattcataagccttgttgcatcgggtatgagctctttcaatgtacccatcttctcattctgcagagcgcagagatctg |
6640432 |
T |
 |
| Q |
184 |
caagctttcaacttgatcgag |
204 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6640431 |
caagctttcaacttgatcgag |
6640411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University