View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15952_low_10 (Length: 351)
Name: NF15952_low_10
Description: NF15952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15952_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 17 - 346
Target Start/End: Original strand, 6640022 - 6640350
Alignment:
| Q |
17 |
actacatgtgtttttatgttaactttttt-gtggtaacttcttcatgaagcttgaacaatattccttagctttaatggttctatgacccaacttttgtca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
6640022 |
actacatgtgtttttatgttaactttttttgtggtaacttcttcatgaagcttgaacaatattccttagcttgaatggttctatgacc----ttttgtca |
6640117 |
T |
 |
| Q |
116 |
ttgttcgaattatattgttgtttgtatacttgtactatattttggtgtgaaaaacatgcttcttattaattttataacatattattgctctccaattttc |
215 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6640118 |
ttgttctaactatattgttgtttggatacttgtactatattttggtgtgaaaaacatgcttcttattaattttataacatattattgctctccaattttc |
6640217 |
T |
 |
| Q |
216 |
taggttgatacaa--gatatgaatattcaaacgaaggtatcacaaacctttagaaccaataaatttttatttaatacttcaatgctgtcatggttttata |
313 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6640218 |
taggttgatacaactgatatgaatattcaaacgaaggaatcacaaacctttagaaccaataaatttttatttaatacttcaatgctgtcatggttttata |
6640317 |
T |
 |
| Q |
314 |
gatctatgatatttaatttgtgatgttggtttc |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6640318 |
gatctatgatatttaatttgtgatgttggtttc |
6640350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 246 - 294
Target Start/End: Original strand, 15129701 - 15129749
Alignment:
| Q |
246 |
gaaggtatcacaaacctttagaaccaataaatttttatttaatacttca |
294 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15129701 |
gaaggtatcacatacctttagaaccaataaatttttatttagtacttca |
15129749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University