View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15952_low_13 (Length: 251)
Name: NF15952_low_13
Description: NF15952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15952_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 15 - 154
Target Start/End: Complemental strand, 5527018 - 5526879
Alignment:
| Q |
15 |
tatagataatcaatgtgaaacaacgaaatataatgaattataaatatttacattttccagattattgatggtggatttgctgaaatcactatgatcttca |
114 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5527018 |
tatagataatgaatgtgaaacaacgaaatctaatgaattataaatatttacattttccagattattgatggtggatttgctgaaatcactatgatcttcg |
5526919 |
T |
 |
| Q |
115 |
ttattttagcaaatctagtgaacatgcactaaaatcacta |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5526918 |
ttattttagcaaatctagtgaacatgcactaaaattacta |
5526879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 151 - 251
Target Start/End: Complemental strand, 5526187 - 5526085
Alignment:
| Q |
151 |
actactttatgtcactcataagtccttggacaataagccaaggcaatcaaaacttaactttcagattacaagaccaccaaa--gggtacgaggggacatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
5526187 |
actactttatgtcactcataagtccttggacaataagccaaggcaatcaaaacttaactttcagattacaagaccacccaagggggtacgaggggacatg |
5526088 |
T |
 |
| Q |
249 |
gtt |
251 |
Q |
| |
|
||| |
|
|
| T |
5526087 |
gtt |
5526085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University