View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15952_low_17 (Length: 228)

Name: NF15952_low_17
Description: NF15952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15952_low_17
NF15952_low_17
[»] chr6 (2 HSPs)
chr6 (82-215)||(3846794-3846927)
chr6 (178-212)||(3846714-3846748)


Alignment Details
Target: chr6 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 82 - 215
Target Start/End: Complemental strand, 3846927 - 3846794
Alignment:
82 cgttagaaattggttaggttgttgttgaattttgagagagaattgagctgaattcgaagatggatgcttcatatttactggccatgcagcactaacactt 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||    
3846927 cgttagaaattggttaggttgttgttgaattttgagagagaattgagctgaattcgaagatggatacttcatatttactggccatgcagcactgacaatt 3846828  T
182 tagattgaatgcatgtccggtatgtgatatgcct 215  Q
    ||||||||||||||||||||||||||||||||||    
3846827 tagattgaatgcatgtccggtatgtgatatgcct 3846794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 212
Target Start/End: Complemental strand, 3846748 - 3846714
Alignment:
178 actttagattgaatgcatgtccggtatgtgatatg 212  Q
    |||||||||||||||||||||||||||||||||||    
3846748 actttagattgaatgcatgtccggtatgtgatatg 3846714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University