View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15952_low_17 (Length: 228)
Name: NF15952_low_17
Description: NF15952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15952_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 82 - 215
Target Start/End: Complemental strand, 3846927 - 3846794
Alignment:
| Q |
82 |
cgttagaaattggttaggttgttgttgaattttgagagagaattgagctgaattcgaagatggatgcttcatatttactggccatgcagcactaacactt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| || |
|
|
| T |
3846927 |
cgttagaaattggttaggttgttgttgaattttgagagagaattgagctgaattcgaagatggatacttcatatttactggccatgcagcactgacaatt |
3846828 |
T |
|
| Q |
182 |
tagattgaatgcatgtccggtatgtgatatgcct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3846827 |
tagattgaatgcatgtccggtatgtgatatgcct |
3846794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 212
Target Start/End: Complemental strand, 3846748 - 3846714
Alignment:
| Q |
178 |
actttagattgaatgcatgtccggtatgtgatatg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3846748 |
actttagattgaatgcatgtccggtatgtgatatg |
3846714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University