View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15952_low_7 (Length: 369)
Name: NF15952_low_7
Description: NF15952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15952_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 19 - 361
Target Start/End: Complemental strand, 37937125 - 37936783
Alignment:
| Q |
19 |
ccttgatccaccttgaggatcagatccgcttacaaaccaacgatcctcacgctcaaatcattgattactttgacatcatcaccggcactggcattggtgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37937125 |
ccttgatccaccttgaggatcagatccgcttacaaaccaacgatcctcacgctcaaatcattgattactttgacatcatcaccggcactggcattggtgc |
37937026 |
T |
|
| Q |
119 |
aatactcgctgcaatgatcacagctgatgatggatttggtagacctctctatactgctagagatgctgtgaatttcattgctgacaggaatcatgaattc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37937025 |
aatactcgctgcaatgatcacagctgatgatggatttggtagacctctctatactgctagagatgctgtgaatttcattgctgacaggaatcatgaattc |
37936926 |
T |
|
| Q |
219 |
tataaaatgaaatccgtcggtgttttccgccggcgccgtagattctcaacgaagagcattgaaaatttgttgaagcgagtttttcaaggaaaagaaagcg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936925 |
tataaaatgaaatccgtcggtgttttccgccggcgccgtagattctcaacgaagagcattgaaaatttgttgaagcgagtttttcaaggaaaagaaagcg |
37936826 |
T |
|
| Q |
319 |
aaggtaaatctttgacgttgaaagatacgattaagcctttgct |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936825 |
aaggtaaatctttgacgttgaaagatacgattaagcctttgct |
37936783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University