View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15954_high_24 (Length: 330)
Name: NF15954_high_24
Description: NF15954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15954_high_24 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 19 - 330
Target Start/End: Complemental strand, 31088293 - 31087982
Alignment:
| Q |
19 |
ccttggcgccggtccggcccacgctgtttatttctccgtttatgaaacacttaagaagaaattctcacatggaaatgttaacgatcattttgttcatgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31088293 |
ccttggcgccggtccggcccacgctgtttatttctcggtttatgaaacacttaaaaagaaattctcacatggaaatgttaacgatcattttgttcatgct |
31088194 |
T |
 |
| Q |
119 |
ggttcgggggtttgcgcgacggtggcgagtgacgcggtgtttacgccaatggatatggtgaaacagagattgcagttgagtaatagtggttataaaggtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31088193 |
ggttcgggggtttgcgcgacggtggcgagtgacgcggtttttacgccgatggatatggttaaacagagattgcagttgagtaatagtggttataaaggtg |
31088094 |
T |
 |
| Q |
219 |
tgtttgattgtgtgaagagggttttgagtgaggaagggtttggtgctttttatgctagttataggactactgttttgatgaatgcgccttttactgctgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31088093 |
tgtttgattgtgtgaagagggttttgagtgaggaagggtttggtgctttttatgctagttataggactactgttttgatgaatgcgccttttaccgctgt |
31087994 |
T |
 |
| Q |
319 |
gcatttcgcgac |
330 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31087993 |
gcatttcgcgac |
31087982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University