View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15954_high_30 (Length: 271)
Name: NF15954_high_30
Description: NF15954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15954_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 253
Target Start/End: Original strand, 32294336 - 32294580
Alignment:
| Q |
11 |
cataggtacggttttgagctgtaaacacatacatttcccatttaataatggcatgcctgcaacacgaga--tgcgtatcctaaacacaaatgcaaggtca |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32294336 |
cataagtacggttttgagctgtaaacacatacatttcccatttaataatggcatgcctgcaacacgagagatgcgtatcctaaacacaaatgcaaggtca |
32294435 |
T |
 |
| Q |
109 |
ttaattttggattaatgtcgtatcagtaataaatttagcattatattagaatttaattgtccatcataattcagttgacagagacaaacattgtcatata |
208 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||| | ||||| |
|
|
| T |
32294436 |
ttaattttggattaatgtcgtatcaataataaatttagcattatattagaatttaattgcctatcataattcagttgacagagacaaatattattatata |
32294535 |
T |
 |
| Q |
209 |
cagagaccgaaaaccccacttattcacattgatatagtcattaat |
253 |
Q |
| |
|
| | || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32294536 |
cggggatcgaaaaccccacttattcacattgatatagtcattaat |
32294580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University