View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15954_high_32 (Length: 251)
Name: NF15954_high_32
Description: NF15954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15954_high_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 12242722 - 12242897
Alignment:
| Q |
15 |
gaacctgaaaccttaacaaaatcatggtaaaatttcaagtcaacccaaatgggttccccttgtcattcacttctgtgttatgcttatgtactttttattc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12242722 |
gaacctgaaaccttaacaaaatcatggtaaaatttcaagtcaacccaaatgggttccccttgtcattcacttctgtgttatgcttatgtactttttattc |
12242821 |
T |
 |
| Q |
115 |
cttggaataggatttactcacacattttcatgg-aataagagataactttccattaccacatcatttgaacacattaa |
191 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12242822 |
ctaggaataggatttact--cacattttcatggaaataagagataactttccattaccacatcatttgaacacattaa |
12242897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University