View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15954_high_39 (Length: 217)
Name: NF15954_high_39
Description: NF15954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15954_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 35 - 198
Target Start/End: Original strand, 51099022 - 51099185
Alignment:
| Q |
35 |
gaattaaactcactaatgaaatacacatttaaggaccaaattgatgaatgaaaaaatactttaaaaaatgtttttgcaatttcggtataccaaaagttat |
134 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
51099022 |
gaattaaactcactaatgaaatacacagttaaggaccaaattgatgaatgaaaaaatactctaaaaaatgtttttgcaattgcgttataccaaaagttat |
51099121 |
T |
 |
| Q |
135 |
cacaaagaaaattaccaaaataattgattacttgagnnnnnnntggtttggaatctaaataagc |
198 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51099122 |
cacaaagaaaatttccaaaataattgattacttgagaaaaaaatggtttggaatctaaataagc |
51099185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University