View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15954_high_40 (Length: 216)

Name: NF15954_high_40
Description: NF15954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15954_high_40
NF15954_high_40
[»] chr4 (1 HSPs)
chr4 (18-162)||(1813739-1813883)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 162
Target Start/End: Complemental strand, 1813883 - 1813739
Alignment:
18 tgaagagcttcacttttgaacttgatcgtgtatagacacaacattatggtatattcacatgttttcttctaattttttggaacaaagtttcatatgcttc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1813883 tgaagagcttcacttttgaacttgatcgtgtatagacacaacattatggtatattcacatgttttcttctaattttttggaacaaagtttcatatgcttc 1813784  T
118 taaaatatagatggttatacctcatatgccagatactacatttga 162  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
1813783 taaaatatagatggttatacctcatatgccagatactacatttga 1813739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University