View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15954_low_10 (Length: 513)
Name: NF15954_low_10
Description: NF15954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15954_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 126 - 498
Target Start/End: Original strand, 28543819 - 28544191
Alignment:
| Q |
126 |
ggccaacattttaccgaatatggaaaaagaagtcgacggaaggattccaatcgttgccttacttggtggctctattcagctccatgttatggttatatta |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28543819 |
ggccaacattttaccgaatatggaaaaagaagtcgacggaaggattccaatcgttgccatacttggttgctctattcagctccatgttatggttatatta |
28543918 |
T |
 |
| Q |
226 |
tggtttcgtcaagaaacatgcttttctactcattacgattaattcagctgggtgtgtcattgaaacaatatatatcgtcacatacctaatctacgccacc |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28543919 |
tggtttcgtcaagaaacatgcttttctactcattaccattaattcagctgggtgtgtcattgaaacaatatatatcgtcacatacctaatctacgccacg |
28544018 |
T |
 |
| Q |
326 |
aaagatgcgagggtaaaccctaatcaccgattatacttacnnnnnnnnnnnnnnnnnnnactaatcaacttgatatgacaagtataatctcattagtttt |
425 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28544019 |
aaagatgcaagggtaaaccctaatcaccgattatacttactttttagttttatttttttactaatcaacttgatatgacaagtataatctcattagtttt |
28544118 |
T |
 |
| Q |
426 |
gttctaacatgatttttaatcatagatcttgacgattaaattgttcatggcgatgaatgtggcctgttctgtg |
498 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28544119 |
gttctaacatgatttttaatcgtagatcttgacgattaaattgttcatggcgatgaatgtggcctgttctgtg |
28544191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 19 - 50
Target Start/End: Original strand, 28543712 - 28543743
Alignment:
| Q |
19 |
acttggcacccctgtaagtatatgttaatttc |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28543712 |
acttggcacccctgtaagtatatgttaatttc |
28543743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University