View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15954_low_28 (Length: 315)
Name: NF15954_low_28
Description: NF15954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15954_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 16 - 296
Target Start/End: Complemental strand, 12243347 - 12243069
Alignment:
| Q |
16 |
catattcaagaacaagcatggggaatatttaaaacatttcccacttgttatacactaataaatgcaaatgcaatcgcaaatttaactattgtataccgca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12243347 |
catattcaagaacaagcatggggaatatttaaaacatttcccactttttatccactaataaatgcaaatgcaatcgcaaatttaactattgtataccgca |
12243248 |
T |
|
| Q |
116 |
acaga-tttcttttagttcggaaattgtttatgtatgcttttagtagaatttgattgatttgattttagtttcttagtgggttgatgtcttgatgtggga |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
12243247 |
acagattttcttttagttcggaaattgtttgtgtatgcttttagtataatttgattgatttgatttcagtttcttattgggttgatgtcttgatgtggga |
12243148 |
T |
|
| Q |
215 |
cttgaaccacgagtggtggtagccttacacggttgaacactttgaacatcatatattcatcaaaaatcttaattaaggtgtg |
296 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12243147 |
cttgaaccacga---gtggtagccttacacggttggacactttgaacatcatatattcaccaaaaatcttaattaaggtgtg |
12243069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University