View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15954_low_32 (Length: 271)

Name: NF15954_low_32
Description: NF15954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15954_low_32
NF15954_low_32
[»] chr4 (1 HSPs)
chr4 (11-253)||(32294336-32294580)


Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 253
Target Start/End: Original strand, 32294336 - 32294580
Alignment:
11 cataggtacggttttgagctgtaaacacatacatttcccatttaataatggcatgcctgcaacacgaga--tgcgtatcctaaacacaaatgcaaggtca 108  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||    
32294336 cataagtacggttttgagctgtaaacacatacatttcccatttaataatggcatgcctgcaacacgagagatgcgtatcctaaacacaaatgcaaggtca 32294435  T
109 ttaattttggattaatgtcgtatcagtaataaatttagcattatattagaatttaattgtccatcataattcagttgacagagacaaacattgtcatata 208  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||| | |||||    
32294436 ttaattttggattaatgtcgtatcaataataaatttagcattatattagaatttaattgcctatcataattcagttgacagagacaaatattattatata 32294535  T
209 cagagaccgaaaaccccacttattcacattgatatagtcattaat 253  Q
    | | || ||||||||||||||||||||||||||||||||||||||    
32294536 cggggatcgaaaaccccacttattcacattgatatagtcattaat 32294580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University