View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15954_low_38 (Length: 231)
Name: NF15954_low_38
Description: NF15954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15954_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 217
Target Start/End: Original strand, 31216842 - 31217040
Alignment:
| Q |
19 |
gtttacagcttcggagttctttgttttgaaatccttctgggaaagcatccagcagatttcatttcctcattgttctcatcatctacagcaaaaatgactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31216842 |
gtttacagcttcggagttctttgttttgaaatccttctgggaaagcatccagcagatttcatttcctcattgttctcatcatctacagcaaaaatgactt |
31216941 |
T |
|
| Q |
119 |
ataatttgctgttgatcgatgtgttagataaccgccctcctcaacctatcaattcaattgttgaggacatcatcttgattacaaaattggcatattctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31216942 |
ataatttgctgttgatcgatgtgttagataaccgccctcctcaacctatcaattcaattgttgaggacatcatcttgattacaaaattggcattttctt |
31217040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University