View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15954_low_41 (Length: 222)
Name: NF15954_low_41
Description: NF15954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15954_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 22762886 - 22763093
Alignment:
| Q |
1 |
ggttcactgtctattgatagctagtccaatccacccttaatacagtgattttgccttctctacaataagaacttaatcgactatagtcaactgattacgc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22762886 |
ggttcactgtctatcgatagctagtccaatccacccttaatacagtgattttgccttctctacaataagaacttaatcgactatagtcaactgattacgc |
22762985 |
T |
|
| Q |
101 |
gtactaagatatcccttatacagtagactacaccatataggaattgctttgaatataaatatataatgatcgagacgtcgatccttacttttatatgatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
22762986 |
gtactaagatatcccttatacagtagactacaccatataggaattgctttgaatataaatatatattgatcgagacgttgatccttacttttatatgatg |
22763085 |
T |
|
| Q |
201 |
cgcctttg |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
22763086 |
cgcctttg |
22763093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University