View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15955_high_8 (Length: 206)
Name: NF15955_high_8
Description: NF15955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15955_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 7266029 - 7265852
Alignment:
| Q |
16 |
tacttttaacgacagggctgcgatgcatcaattttgttggacgatagcgccacaattgtcagtgnnnnnnntggtggacctaacaaaaattccattcgag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
7266029 |
tacttttaacgacagggctgcgatgcatcaattttgttggacgatagcgccacaattgtcagtgaaaaaaatggtggacctaacaaaaattccgttcgag |
7265930 |
T |
 |
| Q |
116 |
gttttgaagtgattgatgagatcaaatctaagttggaacaagcatgtcctcgtacagtctcatgtgcagatattgttg |
193 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7265929 |
gttttgaagtgatcgatgagatcaaatctaagttggaacaagcatgtcctcgtacagtctcatgtgcagatattgttg |
7265852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University