View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15956_high_12 (Length: 318)
Name: NF15956_high_12
Description: NF15956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15956_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 53 - 246
Target Start/End: Original strand, 2062781 - 2062974
Alignment:
| Q |
53 |
ttatcgtatcgtagttgaaatatcgcgagaagagttaaaaaggaggatattttgacggtgaaggagaaaatgattaatttcgttgtcgacagaagcttta |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2062781 |
ttatcgtatcgtagttgaaatatcgcgagaagagttaaaaaggaggatattttgacggtgaaggagaaaatgattaatttcgttgtcgacagaagcttta |
2062880 |
T |
|
| Q |
153 |
tgtttttgtgtggcgtacacagaatgcgttgtcagctggcatggcagataaactcttaaaagtgtacgaacatcgttccatggaataattattc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2062881 |
tgtttttgtgtggcgtacacagaatgcgttgtcagctggcatggcagataaactcttaaaagtgtacgaacatcgttccatggaataattattc |
2062974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 279 - 318
Target Start/End: Original strand, 2063005 - 2063044
Alignment:
| Q |
279 |
gaataaagtactctactcaaaataacaaaggacaattgat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2063005 |
gaataaagtactctactcaaaataacaaaggacaattgat |
2063044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University