View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15956_low_1 (Length: 377)
Name: NF15956_low_1
Description: NF15956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15956_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 22 - 98
Target Start/End: Complemental strand, 43170100 - 43170023
Alignment:
| Q |
22 |
ttgaagtaagttactagcgagctgcaagtttgacagtgtcactgatttgctatttgattaaat-ttttacactctatt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43170100 |
ttgaagtaagttactagcgagctgcaagtttgacagtgtcactgatttgctatttgattaaattttttacactctatt |
43170023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University