View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15958_high_7 (Length: 236)
Name: NF15958_high_7
Description: NF15958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15958_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 34254417 - 34254637
Alignment:
| Q |
1 |
acacgacaatgatatagcccttggatgaaaaatgtgcagcattgcttttttctctctctcccccgtgtattgtatcctacccgttgattccaacgtcgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34254417 |
acacgacaatgatatagcccttggatgaaaaatgtgcagcattgcttttttctctctctcccccgtgtattgtatcctacccgttgattccaacgtcgtg |
34254516 |
T |
 |
| Q |
101 |
ctaaatagcactgctccttaatttatgctcattgcaatgttgcttttgttgagaggttgacttcccgaaaaggctgtccacacggagggttttgacaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34254517 |
ctaaatagcactgctccttaatttatgctcattgcaatgttgcttttgttgagaggttgacttcccgaaaaggctgtccacacggagggttttgacaggt |
34254616 |
T |
 |
| Q |
201 |
gagaaatttaagtgaagtgtc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34254617 |
gagaaatttaagtgaagtgtc |
34254637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 2 - 100
Target Start/End: Original strand, 3450103 - 3450200
Alignment:
| Q |
2 |
cacgacaatgatatagcccttggatgaaaaatgtgcagcattgcttttttctctctctcccccgtgtattgtatcctacccgttgattccaacgtcgtg |
100 |
Q |
| |
|
||||||| | ||||| |||||||||||| ||||||||||||||||||| | |||||||||||| |||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
3450103 |
cacgacactaatataacccttggatgaataatgtgcagcattgcttttat-tctctctcccccatgtagtgtatgctatccgttgattccaacgtcgtg |
3450200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 99
Target Start/End: Complemental strand, 40891791 - 40891704
Alignment:
| Q |
12 |
atatagcccttggatgaaaaatgtgcagcattgctttt-ttctctctctcccccgtgtattgtatcctacccgttgattccaacgtcgt |
99 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||||||| ||||||| | ||||| |||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
40891791 |
atataacccttggatgaagaatgtgcaacattgcttttattctctc-cccccccatgtattgtatgctatccgttgatttcaacgtcgt |
40891704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University