View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15958_low_3 (Length: 409)
Name: NF15958_low_3
Description: NF15958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15958_low_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 59 - 409
Target Start/End: Complemental strand, 42342756 - 42342406
Alignment:
| Q |
59 |
gactggttttgactttagtatattcttcttggttcttgatctgcatcatgtgcacttttctcagttttaactacacaagaagatgcacttatgcatcaag |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42342756 |
gactggttttgactttagtatattcttcttggttcttgatctgcatcatgtgcacttttctcagttttaactacacaagaagatgcacttatgcatcaag |
42342657 |
T |
 |
| Q |
159 |
gatttcactctttaccatgtgatgttttcttcacagatgacaacttgtattccttcttaagcctctcagtttctcttttgctttctgagctttcgtttga |
258 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42342656 |
gatttcactctctaccatgtgatgttttcttcacagatgacaacttgtattccttcttaagcctctcagtttctcttttgctttctgagctttcgtttga |
42342557 |
T |
 |
| Q |
259 |
actctcacgtttgtttcctctaaacactgcatgagataatcataagacagtaatttagatttgatttcaatccatttgattcaaaataaaaggagtttta |
358 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42342556 |
actctcacgtttgtttcctctgaacactgcatgagataatcataagacagtaatttagatttgatttcaatccatttgattcaaaataaaaggagtttta |
42342457 |
T |
 |
| Q |
359 |
atgtctctaaattttctatggctaattatagtttagaccatcattggttac |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42342456 |
atgtctctaaattttctatggctaattatagtttagaccatcattggttac |
42342406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University