View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15958_low_6 (Length: 250)
Name: NF15958_low_6
Description: NF15958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15958_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 90 - 234
Target Start/End: Complemental strand, 26806366 - 26806220
Alignment:
| Q |
90 |
acttgctcttttaccattcaggctaattaatgagcttgtcccgtttgtttata--gcttaagatacaatattttttctgaaggagctaaagatacaactt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
26806366 |
acttgctcttttaccattcaggctaattaatgagcttgtcccgtttgtttatatagcttaagatacaatatttattttgaaggagctaaagatacaactt |
26806267 |
T |
 |
| Q |
188 |
acgactccatgctgcagttattgtctatgaattttgatctattcaat |
234 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
26806266 |
acgactccatgctgcaattattgtctttgaattttgatctattcaat |
26806220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 75
Target Start/End: Complemental strand, 26806417 - 26806387
Alignment:
| Q |
45 |
ctcccaaaccatttcaaattttttcaatata |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26806417 |
ctcccaaaccatttcaaattttttcaatata |
26806387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University