View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15959_high_1 (Length: 232)
Name: NF15959_high_1
Description: NF15959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15959_high_1 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 20 - 232
Target Start/End: Complemental strand, 41561821 - 41561609
Alignment:
| Q |
20 |
ggggagatgttaagagtttgagatagtctctccaataattaaaactctctgctggaggatggaagctagtgccatgcctgatgggtgagaggggatcgcc |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41561821 |
ggggagatgttaagagtttgagataatctctccaataattaaaactctctgctggaggatggaagctagtgccatgcctgatgggtgagaggggatcgcc |
41561722 |
T |
|
| Q |
120 |
atcgtcaccagactcctccttttcctccgatggcaaattataaaactcgtgagnnnnnnncatcaactcctgcattagactctcaggaactccatggttt |
219 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41561721 |
atcgtcaccaaactcctccttttcctcctctggcaaattataaaactcgtgagtttttttcatcaactcctgcattagactctcaggaactccatggttt |
41561622 |
T |
|
| Q |
220 |
gtgagctgaacat |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41561621 |
gtgagctgaacat |
41561609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 232
Target Start/End: Complemental strand, 41556949 - 41556737
Alignment:
| Q |
20 |
ggggagatgttaagagtttgagatagtctctccaataattaaaactctctgctggaggatggaagctagtgccatgcctgatgggtgagaggggatcgcc |
119 |
Q |
| |
|
||||||||||||||| |||||| || ||||||||| ||| | ||||||||||||| ||||||||||||||||||| ||||||||||||| || || || |
|
|
| T |
41556949 |
ggggagatgttaagactttgaggtaatctctccaaaaatgtacactctctgctggaagatggaagctagtgccatgtctgatgggtgagaaaggctcacc |
41556850 |
T |
|
| Q |
120 |
atcgtcaccagactcctccttttcctccgatggcaaattataaaactcgtgagnnnnnnncatcaactcctgcattagactctcaggaactccatggttt |
219 |
Q |
| |
|
|| ||||||| |||| | |||||||||| ||||||| || ||||||| ||| ||||||||||| ||||||||||||||||| |||||| ||| |
|
|
| T |
41556849 |
attgtcaccaaactctttcttttcctccaccggcaaatcatgaaactcgagagattttttcatcaactcctccattagactctcaggaattccatgattt |
41556750 |
T |
|
| Q |
220 |
gtgagctgaacat |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41556749 |
gtgagctgaacat |
41556737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University