View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15959_low_2 (Length: 208)
Name: NF15959_low_2
Description: NF15959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15959_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 42 - 198
Target Start/End: Original strand, 14792052 - 14792200
Alignment:
| Q |
42 |
tatatcaaatgtgagtaagagttctgcattatatgaaaacatagatgttgagcaacacataaatgtctgcacgcatatacttaatgcattaagattttga |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14792052 |
tatatcaaatgtgagtaagagttctgcattatatgaaaacgtagatgttgagcaacacataaatgtctgcacgcatatac--------ttaagattttga |
14792143 |
T |
|
| Q |
142 |
gttatgatgcgatgttcaatctacttgtatggttgcgtaaagctcaagatgatgtcc |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
14792144 |
gttatgatgcgatgttcgatctacttgtatcgttgcgtaaagctcaatgtgatgtcc |
14792200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University